View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_53 (Length: 216)
Name: NF7777_low_53
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 3242285 - 3242413
Alignment:
| Q |
1 |
ctttaggtttaaagcttgaaaatttatatgcaagtggatcaaaatgacctaaaaagagat-------caaatccttatccgaaattaagtttagtccact |
93 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
3242285 |
ctttaggtttaaagtttgaaaattcatatgcaagcggatcaaaatgacctaaaaagagataaatgatcaaatccttatccgaaattaagttaagtccact |
3242384 |
T |
|
| Q |
94 |
atagtagttttgcatgcgtatattcttcg |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
3242385 |
atagtagttttgcatgcgtatattattcg |
3242413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University