View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_55 (Length: 203)
Name: NF7777_low_55
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 43178001 - 43177838
Alignment:
| Q |
17 |
acatcatttgagatattgtgttatatatatgaagttcaaaattattttgaaggccaagtttatcatatgggcactgtggcac-tgagctgaatcatgggg |
115 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43178001 |
acattatttgagatattatgttatatatatgaagttcaaaattattttgaaggccaagtttatcatatgggcactgtggcacatgagctgaatcatgggg |
43177902 |
T |
|
| Q |
116 |
tagcaattgtggggtatggagaaattcgagatggaagaaaatgtgcgtttccatttgattgttt |
179 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43177901 |
tagcaattgtggggtatggagaaactcgagatggaagaaaatgtgcgtttccatttgattgttt |
43177838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 43171932 - 43171870
Alignment:
| Q |
17 |
acatcatttgagatattgtgttatatatatgaagttcaaaattattttgaaggccaagtttat |
79 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43171932 |
acatgatttgagatatcgtgttatatatatgaagttcaaaattattttgaaggccaagtttat |
43171870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 88 - 157
Target Start/End: Complemental strand, 43180487 - 43180418
Alignment:
| Q |
88 |
cactgtggcactgagctgaatcatggggtagcaattgtggggtatggagaaattcgagatggaagaaaat |
157 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| || || |||||||| ||||| |
|
|
| T |
43180487 |
cactgtggtactgagctgaatcatggggtagcaattgtggggtatggagcaactcaagatggaacaaaat |
43180418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University