View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7778_low_7 (Length: 254)
Name: NF7778_low_7
Description: NF7778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7778_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 109 - 236
Target Start/End: Complemental strand, 38964397 - 38964270
Alignment:
| Q |
109 |
gtagtattattttttgaaagcatcaaattctaactnnnnnnncagagtagggaaaattaacattttaaacaaagaaacaattctaaatgttacgaatatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38964397 |
gtagtattattttttgaaagcatcaaattctaactaaaaaaacagagtagggaaaattaacattttaaacaaagaaacaattctaaatgttacgaatatt |
38964298 |
T |
|
| Q |
209 |
tgttagtatgaacatttaatgaaatctt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38964297 |
tgttagtatgaacatttaatgaaatctt |
38964270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 7 - 111
Target Start/End: Complemental strand, 38964625 - 38964521
Alignment:
| Q |
7 |
tttggtggtccaatgtgcacagtgcacagattcaccttgtcttcttcatttccaactttggctacttcagtttttctcatgagtttttatcgagtacaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38964625 |
tttggtggtccaatgtgcacagtgcacagattcaccttgtcttcttcatttccaactttggctacttcagtttttctcatgagtttttatcgagtacaac |
38964526 |
T |
|
| Q |
107 |
tagta |
111 |
Q |
| |
|
||||| |
|
|
| T |
38964525 |
tagta |
38964521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University