View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7779_high_28 (Length: 248)
Name: NF7779_high_28
Description: NF7779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7779_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 19572128 - 19571898
Alignment:
| Q |
1 |
ttaaacattacaactccggttttcaatttcaaccggtcgatcttaatcaatggcaaagatagtttaaagttgannnnnnnn--atcagagacggtttaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
19572128 |
ttaaacattacaactccggttttcaatttcaaccggtcgatcttaatcaatggcaaagatagtttaaagttgattttttttttatcagagatggtttaaa |
19572029 |
T |
 |
| Q |
99 |
attgattttgttgttgcgtaatctaagttgtctgatcttaatgcaaaaatatgtgcgcttctcttaaattagggaaccctgtccttcactcttctattat |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||| ||||||||| |||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
19572028 |
attgattttgttattgcgtaatctaagttttctgatcttaatgcataaatatgtgtgcttctcttagattagggaaccccgtccttcactcttctattat |
19571929 |
T |
 |
| Q |
199 |
attacttcgtgccaagcaccatcgcgcattc |
229 |
Q |
| |
|
||||| |||||||||||||||| |||||||| |
|
|
| T |
19571928 |
attacatcgtgccaagcaccattgcgcattc |
19571898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University