View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7779_high_37 (Length: 228)
Name: NF7779_high_37
Description: NF7779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7779_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 3118872 - 3119076
Alignment:
| Q |
1 |
tttaaaaggtaattgttataaattattaaaataaggaatatcaataaactcttgcaaagcatctttattaccacttggtattaatccgaaaatcaagccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3118872 |
tttaaaaggtaattgttataaattattaaaataaggaatatcaataaactcttgcaaagcatctttattaccacttggtattaatccgaaaatcaagccc |
3118971 |
T |
|
| Q |
101 |
taaatggcagtaacgtcacataaactattgaacagacaaggtggcagtggcagtggcatctcaacaatgctctatcaatggttacttaccatcaaattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3118972 |
taaatggcagtaacgtcacataaactattgaacagacaaggtggcagtggcagtagcatctcaacaatgctctatcaatggttacttaccatcaaattga |
3119071 |
T |
|
| Q |
201 |
tatgc |
205 |
Q |
| |
|
||||| |
|
|
| T |
3119072 |
tatgc |
3119076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University