View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7779_low_42 (Length: 229)
Name: NF7779_low_42
Description: NF7779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7779_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 15618422 - 15618602
Alignment:
| Q |
18 |
gaacaatgaacatctaaactaaagtttaaaaaaggacatcatttgcacccttaagcgagatctctatttttctattcaaggtgataactagccaaatgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15618422 |
gaacaatgaacatctaaactaaagtttaaaaaaggacatcatttgcacccttaagcgagatctctatttttctattcaaggtgacaactagccaaatgat |
15618521 |
T |
|
| Q |
118 |
aacttgtgatttaacataaccctgtctagtgtatgtaaattctttcttatttgctattctttttgtatatgtcttaccattt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
15618522 |
aacttgtgatttaacataaccctgtctagtgtatgtaaattctttcttattagctattc-ttttgtatatgccttaccattt |
15618602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 103 - 167
Target Start/End: Complemental strand, 1601314 - 1601250
Alignment:
| Q |
103 |
aactagccaaatgataacttgtgatttaacataaccctgtctagtgtatgtaaattctttcttat |
167 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
1601314 |
aactagccaaatcataacttgtgatttaacataaccctgcctagtgtatggaaattccttcttat |
1601250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 103 - 167
Target Start/End: Original strand, 8527743 - 8527807
Alignment:
| Q |
103 |
aactagccaaatgataacttgtgatttaacataaccctgtctagtgtatgtaaattctttcttat |
167 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
8527743 |
aactagccaaatcataacttgtgatttaacataaccctgcctagtgtatggaaattccttcttat |
8527807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 48362951 - 48362895
Alignment:
| Q |
103 |
aactagccaaatgataacttgtgatttaacataaccctgtctagtgtatgtaaattc |
159 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
48362951 |
aactagccaaatcataacttgtgatttaacataaccctgcccagtgtatggaaattc |
48362895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University