View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7779_low_44 (Length: 227)
Name: NF7779_low_44
Description: NF7779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7779_low_44 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 15393457 - 15393683
Alignment:
| Q |
11 |
cagagagttacatatctgt---tacacggtggtgatttggcgtcgttgaggatcggcggtgtgacaatatgttgggaagaacggacatttgttaaataat |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15393457 |
cagagagttacatatctgtaattacacggtggtgatttggcgtcgttgaggatcggcggtgagacattatgttgggaagaacggacatttgttaaataat |
15393556 |
T |
 |
| Q |
108 |
ttgtttacttagctaaaatcttgttgatgaatggaaccacccagtgaagtgttttacttttgcttc-------agaatgttttgttttctgttaggagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
15393557 |
ttgtttacttagctaaaatcttgttgatgaatggaaccacccagtgaagtgttttacttttgcttcattaaagagcatgttttgttttctgttaggagcc |
15393656 |
T |
 |
| Q |
201 |
ctcaaacatcagttcaaaaagttagat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15393657 |
ctcaaacatcagttcaaaaagttagat |
15393683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University