View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7779_low_5 (Length: 241)
Name: NF7779_low_5
Description: NF7779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7779_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 102 - 223
Target Start/End: Original strand, 36206493 - 36206614
Alignment:
| Q |
102 |
ttctttgacaagagaaacgcacagatttggcagcttgtccacttccggtggcaacatcccaagcgaggttgtgagagggagttttagaagctatgaattg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36206493 |
ttctttgacaagagaaacgcacagatttgggagcttgtccacttccggtggcaacgtcccaaacgaggttgtgagagggagttttagaagctatgaattg |
36206592 |
T |
|
| Q |
202 |
gaagagttgtgccggataactt |
223 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
36206593 |
gaagagttgtggtggataactt |
36206614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 223
Target Start/End: Complemental strand, 35399125 - 35399024
Alignment:
| Q |
122 |
acagatttggcagcttgtccacttccggtggcaacatcccaagcgaggttgtgagagggagttttagaagctatgaattggaagagttgtgccggataac |
221 |
Q |
| |
|
||||||||||| ||||| |||||||| || |||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35399125 |
acagatttggcggcttggccacttccagtagcaacatcccaaacaaggttgtgagagggagttttagaagctatgaattgaaagagttgtggtggataac |
35399026 |
T |
|
| Q |
222 |
tt |
223 |
Q |
| |
|
|| |
|
|
| T |
35399025 |
tt |
35399024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 223
Target Start/End: Complemental strand, 35401853 - 35401752
Alignment:
| Q |
122 |
acagatttggcagcttgtccacttccggtggcaacatcccaagcgaggttgtgagagggagttttagaagctatgaattggaagagttgtgccggataac |
221 |
Q |
| |
|
||||||||||| ||||| |||||||| || |||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35401853 |
acagatttggcggcttggccacttccagtagcaacatcccaaacaaggttgtgagagggagttttagaagctatgaattgaaagagttgtggtggataac |
35401754 |
T |
|
| Q |
222 |
tt |
223 |
Q |
| |
|
|| |
|
|
| T |
35401753 |
tt |
35401752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 118 - 223
Target Start/End: Original strand, 36210276 - 36210381
Alignment:
| Q |
118 |
acgcacagatttggcagcttgtccacttccggtggcaacatcccaagcgaggttgtgagagggagttttagaagctatgaattggaagagttgtgccgga |
217 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||| || |||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36210276 |
acgcacagatttggcagcttggccggttcctgtggccacgtcccaagcaaggtcgtgagagggagttttagaagctatgaattggaagagttgtggtgga |
36210375 |
T |
|
| Q |
218 |
taactt |
223 |
Q |
| |
|
|||||| |
|
|
| T |
36210376 |
taactt |
36210381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University