View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7779_low_7 (Length: 212)
Name: NF7779_low_7
Description: NF7779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7779_low_7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 43050980 - 43051199
Alignment:
| Q |
1 |
atatctagtatgacgaatgaccaaaaatatatatcttagcaaaaatagatttctttcaagtatgcaagagttagaaagaatggtgca-------catcat |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
43050980 |
atatctagtatgacgaatgaccaaaaatatacatcttagcaaaaatagatttctttcaagtatgcaagagttagaaagaatggtgaatggtgcgcatcat |
43051079 |
T |
|
| Q |
94 |
tcttcattttaggtaacaagcaaaatacatatatttttct-ttattattgagtaatagtcatgttgatgatctataatctatttcgggagagagataaga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43051080 |
tcttcattttaggtaacaagcaaaatacacatatttttttattattattgagtaatagtcatgttgatgatctataatctatttcgggagagagataaga |
43051179 |
T |
|
| Q |
193 |
ataggaatagtaaatagaga |
212 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43051180 |
ataggaatagtaaatagaga |
43051199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University