View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7780_high_9 (Length: 250)
Name: NF7780_high_9
Description: NF7780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7780_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 55082369 - 55082131
Alignment:
| Q |
1 |
agcttaacaattgtggtggaggtgatgatggtggtggcgccggtcatcactgatcctaatcatggcgactctgtattcattccagtactgtgttcaacgg |
100 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55082369 |
agcttaacaattatagtggaggtgatgatggtggtggcgccggtcatcactgatcctaatcatggcgactctgtattcattccagtactgtgttcaacgg |
55082270 |
T |
|
| Q |
101 |
aaatcattgtcgaaggttcattgcggttgtgttataatcggtgccctttatctgcctccgatctgcgacatgctgccaccgtagaagtcttgtctgaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55082269 |
aaatcattgtcgaaggttcattgcggttgtgttataatcggtgccctttatctgcctccgatctgcgacatgatgccaccgtagaagtcttgtctgaact |
55082170 |
T |
|
| Q |
201 |
gcagaggactgccgctggttttgttattgtttagttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55082169 |
gcagaggactgccgctggttttgttattgtttacttcat |
55082131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University