View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7780_low_14 (Length: 313)
Name: NF7780_low_14
Description: NF7780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7780_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 38411315 - 38411058
Alignment:
| Q |
18 |
aaaagcatgatgagaagcccttaacttttcttccgttacttatagattggtcatttcccttaatttgaatgacaaaagctgatggggatacgagggcgcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38411315 |
aaaagcatgatgagaagcccttaacttttcttccgttacttatagattggtcatttcccttaatttgaatgacaaaagctgatggggatacgagggcacg |
38411216 |
T |
 |
| Q |
118 |
acaacacgatgacataggtaggaccagtagagaaac----taaggtaaacgatgcaaaagaacggcgatcgtttgcatttctgatgaaaggtgaagagag |
213 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38411215 |
acaacacgaagacatgggtaggaccagtagagaaactaattaaggtaaacgatgcaaaagaacggcgatcgtttgcatttctgatgaaaggtg------- |
38411123 |
T |
 |
| Q |
214 |
atgacaagttttggtttggagggagaatagaaaataacatttggttactaataaaatgacatttcatttc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38411122 |
-----aagttttggtttggagggagaatagaaaataacatttggttactaataaaatgacatttcatttc |
38411058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 214 - 273
Target Start/End: Complemental strand, 1884768 - 1884709
Alignment:
| Q |
214 |
atgacaagttttggtttggagggagaatagaaaataacatttggttactaataaaatgac |
273 |
Q |
| |
|
|||| ||||||| ||||||| ||||||| | ||| |||| |||||||||||||||||||| |
|
|
| T |
1884768 |
atgaaaagtttttgtttggatggagaatgggaaacaacacttggttactaataaaatgac |
1884709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University