View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7780_low_16 (Length: 279)
Name: NF7780_low_16
Description: NF7780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7780_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 28 - 262
Target Start/End: Original strand, 12731103 - 12731337
Alignment:
| Q |
28 |
tttggtgttacaaaattttaatatttattgagaaaactagaatgaacatggccgaaatcttttcatatggttgcgatgcaattgtgcacatgattgaaaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12731103 |
tttggtgttacaaaattttaatatttattgaaaaaattagaatgaacatggccgaaatcttttcatatggttgcgatgtaattgtgcacatgattgaaaa |
12731202 |
T |
 |
| Q |
128 |
tgacacagcaattgcagtatgatgccctatgcaacgacaatattgcagccgcaatttgaagctatggtgtgtgccaagtattgagatcattctagttaaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12731203 |
tgacacagcaattgcagtatgatgccctatgcaacgacaatattgcagccacaatttgaaactatggtgtgtgccaagtattgagatcattctagttaaa |
12731302 |
T |
 |
| Q |
228 |
aaatgaatttttggaacagcagcagtgaacaaggt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12731303 |
aaatgaatttttggaacagcagcagtgaacaaggt |
12731337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University