View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7780_low_20 (Length: 242)
Name: NF7780_low_20
Description: NF7780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7780_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 153 - 226
Target Start/End: Original strand, 19761997 - 19762070
Alignment:
| Q |
153 |
cttcgttcaattttaatggaagaggaagaaggtatcatcagtcaattgccggatgaactgttacaccggattct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
19761997 |
cttcgttcaattttaatggaagaggaagaaggtatcattagtcaattgccggatgaactgttacaccagattct |
19762070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 114 - 155
Target Start/End: Original strand, 19761900 - 19761941
Alignment:
| Q |
114 |
ctctcattcttgctttctttaatctttaatcttggagctctt |
155 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19761900 |
ctctcattcttgctttccttaatctttaatcttggagctctt |
19761941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University