View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7780_low_8 (Length: 388)
Name: NF7780_low_8
Description: NF7780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7780_low_8 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 229 - 388
Target Start/End: Complemental strand, 21876700 - 21876541
Alignment:
| Q |
229 |
agtctctcaaatcttctccttattaaattgaagcattatcctctcgctttaaactttttattttaacatgcaacgaatactcaacttagtctttgagaaa |
328 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21876700 |
agtctcacaaatcttctccttattaaattgaagcattatcctctcgctttaaactttttattttaacatgcaacgaatactcaacttagtctttgagaaa |
21876601 |
T |
 |
| Q |
329 |
aattgggaatgacaatttagctcatgaggaaaattaaatcaatttttaacttataaaatg |
388 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21876600 |
aattgagaatgacaatttagctcatgaggaaaattaaatcaatttttaacttataaaatg |
21876541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 5 - 105
Target Start/End: Complemental strand, 21876940 - 21876840
Alignment:
| Q |
5 |
gcacgataaattcgtatttataattagtttattgttaattttaaaagtactgcaacaatatatatattgaactcgaagaatttatataaatcattcaaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21876940 |
gcacgataaattcgtatttataattagtttattgttaattttaaaagtactgcaacaatatatatattgaacttgaagaatttatataaatcattcaaaa |
21876841 |
T |
 |
| Q |
105 |
t |
105 |
Q |
| |
|
| |
|
|
| T |
21876840 |
t |
21876840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University