View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7781_high_12 (Length: 217)
Name: NF7781_high_12
Description: NF7781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7781_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 31206234 - 31206413
Alignment:
| Q |
19 |
gagattcgattccacctcttgatggaggaaaagaagttgttttcgagagaattttctcaaattgttttaggatgtggatatttgaacccgtgatgtgtga |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31206234 |
gagattcgattccacctctcgatggaggaaaaaaagttgttttcgagagaattttctcaaattgttttaggatgtggatatttgaacccgggatgtgtga |
31206333 |
T |
|
| Q |
119 |
gattccaacaagggttgtatggcataaagaaaataagaaccaaattgcaaacattattatacttacatttaagcacttgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31206334 |
gattccaacaagggttgtatggcataaagaaaataagaaccaaattgcaaacattattatacttacatttaagcacttgc |
31206413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University