View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7781_high_7 (Length: 281)
Name: NF7781_high_7
Description: NF7781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7781_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 6203920 - 6203669
Alignment:
| Q |
18 |
aatacaccgccttagtcgccagccgcc-gcgaacaatcccgctcattcatcgtcgatgacgacggatttggttacaacgatgaaggcgaagaagaggatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| || || |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6203920 |
aatacaccgccttagtcgccagccgcccgcgaacaatcccgctcatttattgttgatgacgacggatttggttataacgatgaaggcgaagaagaggatt |
6203821 |
T |
|
| Q |
117 |
ggtccaaagccggtttctccctttcctcagacgaagaattcgatggtgaatcggagaaacccaaacggaagaaagagaaagacgcttcacagatcaagcg |
216 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6203820 |
ggtccaaaaccggtttttccctttcctcagacgaagaattcgatggtgaatcggagaaacctcaacggaagaaagagaaagatgcttcacagatcaagcg |
6203721 |
T |
|
| Q |
217 |
tc---ctgtttcttcttctgcggctaaattatcagctgctgctgctatgatg |
265 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6203720 |
tccttctgtttcttcttctgcggctaaattatcagctgctgctgctatgatg |
6203669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University