View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7781_low_12 (Length: 326)
Name: NF7781_low_12
Description: NF7781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7781_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 45746085 - 45746369
Alignment:
| Q |
18 |
acatcactactacttcccattaatcccattggtgaactaataccaggcattgagcgaccatctccaagatcaagtcccattggcaaaggattgccgaggg |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45746085 |
acatcactactacttcccatcaatcccattggtgaactaataccaggcattgagcgaccatctccaagatcaagtcccattggcaaaggattgccgaggg |
45746184 |
T |
 |
| Q |
118 |
agcttgaaccaccaccaaaaccgttccttccaataccaagttccagaccagaatttgaggttggtagagccatgggattagccaatgatgatattggttt |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45746185 |
agcttgaaccaccaccaaaaccattccttccaataccaagttccagaccagaatttgaggttggtagagccatgggattagccaatgatgatattggttt |
45746284 |
T |
 |
| Q |
218 |
gccaaggaacttgtttgttaaggcacatatacggttcaattcgtcctttagacgagcgttttcaattctaatctggtgctcttca |
302 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45746285 |
gccaaggaacttgtttgttaaggcgcatatacggttcaattcatcctttagacgagcgttttcaattctaatctggtgctcttca |
45746369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University