View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7781_low_20 (Length: 248)
Name: NF7781_low_20
Description: NF7781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7781_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 28250076 - 28250309
Alignment:
| Q |
1 |
aaagagtttctcgccgtcgtaggagaatgacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250076 |
aaagagtttctcgccgtcgtaggagaatgacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttg |
28250175 |
T |
|
| Q |
101 |
cagacggtggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctctgaagggaagagattgataatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28250176 |
cagacggtggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagagattgataatta |
28250275 |
T |
|
| Q |
201 |
actgtagaaggcttcgttgttttgatctgatgtc |
234 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
28250276 |
actctagaaggcttcgttgttttgatctgatgtc |
28250309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 190
Target Start/End: Original strand, 32179665 - 32179846
Alignment:
| Q |
9 |
tctcgccgtcgtaggagaatgacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggt |
108 |
Q |
| |
|
||||||||||||||| |||||||| || | ||| |||| || || |||||||| || ||| | | ||||| |||||||||||| ||||| || | |
|
|
| T |
32179665 |
tctcgccgtcgtaggtgaatgacagaaccaagagatcgttcactgttacgtgttccagaatttcagctattcgcttctcgagttcgcgcttgcacgcgct |
32179764 |
T |
|
| Q |
109 |
ggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctctgaagggaagaga |
190 |
Q |
| |
|
|||||||| |||| ||| || |||||||| || ||||| ||||||||||| |||||||| |||||||| || || |||||| |
|
|
| T |
32179765 |
tgaggcgcgtaggtagatagcacaacggagaagacagcagaggaagttgatcggaaaagcagctttctccgacggaaagaga |
32179846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University