View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7781_low_26 (Length: 225)
Name: NF7781_low_26
Description: NF7781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7781_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 69 - 208
Target Start/End: Complemental strand, 12165919 - 12165780
Alignment:
| Q |
69 |
tgtttcttattattattttttggatgctattaggggttattatagatgcagcagttcaaagggatgttcagctaggaaacaagttgagagaagcagaaca |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12165919 |
tgtttcttattattattttttggatgctattaggggttattatagatgcagcagttcaaagggatgttcagctaggaaacaagttgagagaagcagaaca |
12165820 |
T |
|
| Q |
169 |
gatccaaacatgttggttataacctacacttcagaacaca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12165819 |
gatccaaacatgttggttataacctacacttcagaacaca |
12165780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 29999187 - 29999264
Alignment:
| Q |
98 |
ttaggggttattatagatgcagcagttcaaagggatgttcagctaggaaacaagttgagagaagcagaacagatccaa |
175 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||||||| |||| |||||||||||||| |
|
|
| T |
29999187 |
ttaggggatattatagatgtagcagttcaaaagggtgtttagcaagaaaacaagttgaaagaaacagaacagatccaa |
29999264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 100 - 158
Target Start/End: Complemental strand, 10923473 - 10923415
Alignment:
| Q |
100 |
aggggttattatagatgcagcagttcaaagggatgttcagctaggaaacaagttgagag |
158 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
10923473 |
aggggatattacagatgtagcagttcaaaaggatgtttagctaggaaacaagttgagag |
10923415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University