View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7782_high_10 (Length: 368)
Name: NF7782_high_10
Description: NF7782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7782_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 25 - 348
Target Start/End: Complemental strand, 44228609 - 44228283
Alignment:
| Q |
25 |
gttaaccgttctaattaaaactcacgccttatcgaattctattttcagaccaataggtcggcgaaattgaagcagtataagattgatgctcgtcgtgaac |
124 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44228609 |
gttaaccgttctaattcaatctcacgcgttatcgaattctattttcagaccaataggtcggcgaaattgaagcagtataagattgatgctcgtcgtgaac |
44228510 |
T |
|
| Q |
125 |
aatggctatctcaaggtatgtgtgatgttaacatcgatttttcttttgatctattggtttcttaatttgttatctttgttgtggtttttcaggtgcagta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44228509 |
aatggctatctcaaggtatgtgtgatgttaacatcgatttttcttttgatctattggtttcttaatttgttatctttgttgtggtttttcaggtgcagta |
44228410 |
T |
|
| Q |
225 |
aa---gaagggttgcaaggatggattggacgatgatgtccacgtgtcgtcgtcaccggtggggaaacagagcaaacgtgaaatggagaaagtggggacga |
321 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44228409 |
aagaagaagggttgcaaggatggattggacgatgatgtccacgtgtcgtcgtcaccggtggggaaacagagcaaacgtgaaatggagaaagtggggacga |
44228310 |
T |
|
| Q |
322 |
ggcgtagaggtggagaggatgacgtgt |
348 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44228309 |
ggcgtagaggtggagaggatgacgtgt |
44228283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University