View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7782_high_11 (Length: 323)
Name: NF7782_high_11
Description: NF7782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7782_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 23 - 215
Target Start/End: Complemental strand, 31643378 - 31643186
Alignment:
| Q |
23 |
agtaccgacattggtagtagtatgggcgaacaactcggtccttatgagaaggcgcttcaacaagaaaattcacatccggttgaaattaaggaagaaccag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31643378 |
agtaccgacattggtagtagtatgggcgaacaactcggtcattatgagaaggcgcttcaacaagaaaattcacatctggttgaaattaaggaagaaccag |
31643279 |
T |
 |
| Q |
123 |
ataataaagaagagaataatgagttcgatttctggatggtacaatcctctgacatgcttaacttatattctaaccgaaccggagggctaacac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643278 |
ataataaagaagagaataatgagttcgattcccggatggtacaatcctttgacatgcttaacttatattctaaccgaaccggagggctaacac |
31643186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 263 - 311
Target Start/End: Complemental strand, 31643135 - 31643087
Alignment:
| Q |
263 |
catgcctctgtccctcttttagagatggtgaaagcttaccagacatatt |
311 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643135 |
catgcctctgcccctcttttagagatggtgaaagcttaccagacatatt |
31643087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University