View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7782_low_11 (Length: 369)
Name: NF7782_low_11
Description: NF7782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7782_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 154606 - 154712
Alignment:
| Q |
1 |
attacttctatttcaaatatatttttagagctccttatgaaatcaatcttttgtaataaaaaacatactaaacaagacattgaataattaaaagagcact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154606 |
attacttctatttcaaatatatttttagagctccttatgaa-tcaatcttttgtaataaaaaacatactaaacaagacattgaataattaaaagagcact |
154704 |
T |
 |
| Q |
101 |
acttatta |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
154705 |
acttatta |
154712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University