View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7782_low_3 (Length: 640)
Name: NF7782_low_3
Description: NF7782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7782_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 6e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 6e-82
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 428339 - 428173
Alignment:
| Q |
19 |
taattgacactaattgagattgaaaacaaaaaattctttagcaacgttcctcttaattttcttctattgcttcaacccctttcgttggccggtgtccctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
428339 |
taattgacactaattgagattgaaaacaaacaattctttagcaacgttcctcttaattttcttctattgcttcaacccctttcgttggtcggtgtccctt |
428240 |
T |
 |
| Q |
119 |
tgagcttgtattgtgtgatgccatggaggttcttgttctgggtgatggtggggttgtgtacgccgat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
428239 |
tgagcttgtattgtgtgatgccatggaggttcttgttctgggtgatggtggggttgtgtacaccgat |
428173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 509 - 633
Target Start/End: Complemental strand, 428167 - 428043
Alignment:
| Q |
509 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
608 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428167 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
428068 |
T |
 |
| Q |
609 |
tatttgatcccaaactccaaactcg |
633 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
428067 |
tatttgatcccaaacttcaaactcg |
428043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University