View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7783_high_11 (Length: 291)

Name: NF7783_high_11
Description: NF7783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7783_high_11
NF7783_high_11
[»] chr4 (1 HSPs)
chr4 (240-283)||(22188930-22188973)


Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 240 - 283
Target Start/End: Original strand, 22188930 - 22188973
Alignment:
240 tcagtaatggacttcctttcattcttccttagcctatgatgtcc 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
22188930 tcagtaatggacttcctttcattcttccttagcctatgatgtcc 22188973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University