View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7783_high_7 (Length: 346)
Name: NF7783_high_7
Description: NF7783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7783_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 35059008 - 35059196
Alignment:
| Q |
1 |
tttgtagcagttgagattgaaggatatgggagaccaacttcaccttcggtgccttttccgactttgatttctatgctttccaaggtttcgccacaacttg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35059008 |
tttgtagcggttgagattgaaggatatgggagaccaacttcaccttcggtgccttttccgactttgatttctatgctttccaaggtttcgccgcaacttg |
35059107 |
T |
 |
| Q |
101 |
atattgccctgatttgcatgttctataaagctagaaaggtaagtgttggttttgcttcctacttgcatattggtttaagagtcttgata |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059108 |
atattgccctgatttgcaagttctataaagctagaaaggtaagtgttggttttgcttcctacttgcatattggtttaagagtcttgata |
35059196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 223 - 332
Target Start/End: Original strand, 35059230 - 35059339
Alignment:
| Q |
223 |
atcacttgctctatttcttgcaggaaaagaagatttcccgacatgaattgatagaaaaagtgtgacaaattgcaggagacaagttgctgttttcaatcat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059230 |
atcacttgctctatttcttgcaggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttcaatcat |
35059329 |
T |
 |
| Q |
323 |
taagtattat |
332 |
Q |
| |
|
|||||||||| |
|
|
| T |
35059330 |
taagtattat |
35059339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 316
Target Start/End: Original strand, 43897918 - 43897991
Alignment:
| Q |
243 |
caggaaaagaagatttcccgacatgaattgatagaaaaagtgtgacaaattgcaggagacaagttgctgttttc |
316 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||| ||||||| || || ||||||| ||||| ||| ||||||| |
|
|
| T |
43897918 |
caggataagaagatttcgcgacatgaaatgatacaaaaagttagaaaagttgcaggtgacaaattgttgttttc |
43897991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University