View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7783_low_31 (Length: 269)
Name: NF7783_low_31
Description: NF7783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7783_low_31 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 50 - 269
Target Start/End: Complemental strand, 2803643 - 2803424
Alignment:
| Q |
50 |
ttaatgtttatgttaatgttaaagaggttcaataggacaagctggttttcgagatgctacttgattgtactttgtgatggattcaacatcatgcctcaat |
149 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2803643 |
ttaatgttaatgttaatgttaaagaggttcaataggacaagctggttttcgagatgctacttgattgtactttgtgatggattcaacatcatgcctcaat |
2803544 |
T |
|
| Q |
150 |
gtttagcagcggttttctcggtaaagaggatgaatacataccacaactgtcactgccatgctctgattacacattcaaagcaaaggaccacccccactcg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2803543 |
gtttagcagcggttttctcggtaaagaggatgaatacataccacaactgtcactgccatgctctgattacacattcaaagcaaaggaccacccccactcg |
2803444 |
T |
|
| Q |
250 |
gttacttacaatagtgttga |
269 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
2803443 |
gttacttactatagtgttga |
2803424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 2803673 - 2803634
Alignment:
| Q |
32 |
gttaatttgatcaaaatattaatgtttatgttaatgttaa |
71 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2803673 |
gttaattttatcaaaatattaatgtttatgttaatgttaa |
2803634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 2803754 - 2803724
Alignment:
| Q |
1 |
gccagagccatgaattcctaatgcatagtta |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2803754 |
gccagagccatgaattcctaatgcatagtta |
2803724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University