View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7785_high_10 (Length: 250)
Name: NF7785_high_10
Description: NF7785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7785_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 883079 - 883254
Alignment:
| Q |
20 |
caattcattccctgcatatacaattaaaattaggggatcatcccataatttcagtaaattatagtacaaaaattactaattaattagtcttgattaccat |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883079 |
caattcattccctgcatatactattaaaattaggggatcatcccataatttcagtaaattatagtacaaaaattactaattaattagtcttgattaccat |
883178 |
T |
 |
| Q |
120 |
cagggtcatagaagaaaactcgtttgatgttgccattagtagtctcaaaagtctcaatacccttgttctgtaaatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
883179 |
cagggtcatagaagaaaactcgtttgatgttgccattagtagtctcaaaagtctcaatacccttgtcctgtaaatg |
883254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 158
Target Start/End: Original strand, 880561 - 880606
Alignment:
| Q |
113 |
ttaccatcagggtcatagaagaaaactcgtttgatgttgccattag |
158 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||||| |||||||||| |
|
|
| T |
880561 |
ttaccatcagggtcaaaaaagaaaacttgtttgattttgccattag |
880606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University