View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7785_low_11 (Length: 316)

Name: NF7785_low_11
Description: NF7785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7785_low_11
NF7785_low_11
[»] chr7 (1 HSPs)
chr7 (176-303)||(2442847-2442974)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 176 - 303
Target Start/End: Original strand, 2442847 - 2442974
Alignment:
176 tattatagaagatttatgacatagaaaacctaatttatttgactgaagctgctccctacatcgtctaaatgttcttcataacccctgctacattttctat 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||    
2442847 tattatagaagatttatgacatagaaaacctaatttatttgactgaagctactccctacatcgtcaaactgttcttcataacccctgctacattttctat 2442946  T
276 caaacgttcattgccacaaattacagta 303  Q
    ||||||||||||||||||||||||||||    
2442947 caaacgttcattgccacaaattacagta 2442974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University