View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7785_low_13 (Length: 299)
Name: NF7785_low_13
Description: NF7785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7785_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 39 - 183
Target Start/End: Complemental strand, 46018671 - 46018527
Alignment:
| Q |
39 |
tgtcgtttggctcttgtatcggtgctggtgctggcattagcaatggagaatttggagcataacttgaaagtgactttgaactccgttgtggagagggttc |
138 |
Q |
| |
|
|||| |||| |||||| || ||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| | |
|
|
| T |
46018671 |
tgtcatttgcctcttgcattggtgctggtgctgtcagtaacaatggagaatttggagcataacttgaaagtgactttgaactctgttgtggagggggctg |
46018572 |
T |
|
| Q |
139 |
tgatgaactttcacttttaggagccaaactggaaaccaaattctc |
183 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
46018571 |
tgatgaacttgcacttttaggagccaaactggaaaccaaactctc |
46018527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 39 - 183
Target Start/End: Original strand, 46247939 - 46248083
Alignment:
| Q |
39 |
tgtcgtttggctcttgtatcggtgctggtgctggcattagcaatggagaatttggagcataacttgaaagtgactttgaactccgttgtggagagggttc |
138 |
Q |
| |
|
|||| |||| |||||| || ||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| | |
|
|
| T |
46247939 |
tgtcatttgcctcttgcattggtgctggtgctgtcagtaacaatggagaatttggagcataacttgaaagtgactttgaactctgttgtggagggggctg |
46248038 |
T |
|
| Q |
139 |
tgatgaactttcacttttaggagccaaactggaaaccaaattctc |
183 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
46248039 |
tgatgaacttgcacttttaggagccaaactggaaaccaaactctc |
46248083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 46249045 - 46249108
Alignment:
| Q |
201 |
gggatggagcagtggtactaacatgcactgcatcatgaacatgaaataaccttattagcatcaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46249045 |
gggatggagcagtggtactaacatgcactgcatcatgaacatgaaataaccttattagcatcaa |
46249108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 46252318 - 46252381
Alignment:
| Q |
201 |
gggatggagcagtggtactaacatgcactgcatcatgaacatgaaataaccttattagcatcaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46252318 |
gggatggagcagtggtactaacatgcactgcatcatgaacatgaaataaccttattagcatcaa |
46252381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 46199353 - 46199279
Alignment:
| Q |
46 |
tggctcttgtatcggtgctggtgctggcattagcaatggagaatttggagcataacttgaaagtgactttgaact |
120 |
Q |
| |
|
|||||||||||| || |||||||||| | ||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
46199353 |
tggctcttgtattggcgctggtgctgacgcaagcaatggagaatttggagtataacttggtagtgcctttgaact |
46199279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 46 - 120
Target Start/End: Original strand, 34280758 - 34280832
Alignment:
| Q |
46 |
tggctcttgtatcggtgctggtgctggcattagcaatggagaatttggagcataacttgaaagtgactttgaact |
120 |
Q |
| |
|
|||||||||||| || |||||||||| | ||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
34280758 |
tggctcttgtattggcgctggtgctgacgcaagcaatggagaatttggagtataacttggtagtgcctttgaact |
34280832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University