View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7785_low_15 (Length: 291)
Name: NF7785_low_15
Description: NF7785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7785_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 113 - 273
Target Start/End: Original strand, 29655042 - 29655202
Alignment:
| Q |
113 |
caaccttgagtgacaagttaattactatgcaatttacttttcttaagaaactaaattaaagttgggagtattgctatcacaatgttttagtgttttatta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29655042 |
caaccttgagtgacaagttaattactatgcaatttacttttcttaagaaactaaattaaagttgggagtattgctatcacaatgttttagtgttttatta |
29655141 |
T |
|
| Q |
213 |
ggtttttcatctagaggaagagtctttctagtattattttggtttctaatgtgtgtgtact |
273 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29655142 |
ggtttttcatctagaggaagagtcttcctagtattattttggtttctaatgtgtgtgtact |
29655202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University