View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7786_high_8 (Length: 284)
Name: NF7786_high_8
Description: NF7786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7786_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 21 - 253
Target Start/End: Original strand, 34867874 - 34868106
Alignment:
| Q |
21 |
tgtgattatattgaatgatttcattttcccaaaccattcttcgtgtcgacgtgtccgtgtctatatcatgtctagtgtccgtttctgtgtttcatgatat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867874 |
tgtgattatattgaatgatttcattttcccaaaccattcttggtgtcgacgtgtccgtgtctatatcatgtctagtgtccgtttctgtgtttcatgatat |
34867973 |
T |
 |
| Q |
121 |
aaatgttataattcctattcaaatgaaaatgatatcataattgcacattacacatctttcatcagagtatttgcaaaacacaaacatgttatccaaaaca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34867974 |
aaatgttataattcctattcaaatgaaaatgatatcataattgcacattacacatctttcatctgagtatttccaaaacacaaacatgttatccaaaaca |
34868073 |
T |
 |
| Q |
221 |
cacttcacgtgacatttcaaactagcccttatc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34868074 |
cacttcacgtgacatttcaaactagcccttatc |
34868106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 63 - 112
Target Start/End: Complemental strand, 6736494 - 6736445
Alignment:
| Q |
63 |
gtgtcgacgtgtccgtgtctatatcatgtctagtgtccgtttctgtgttt |
112 |
Q |
| |
|
||||||||||||| |||||| | ||||||||||||||||| | ||||||| |
|
|
| T |
6736494 |
gtgtcgacgtgtcagtgtctttgtcatgtctagtgtccgtgtttgtgttt |
6736445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University