View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7787_low_5 (Length: 279)
Name: NF7787_low_5
Description: NF7787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7787_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 153 - 261
Target Start/End: Original strand, 3474051 - 3474159
Alignment:
| Q |
153 |
tatcctcaacattgcaccacaatatagcttgagcaatgagtgagtcatgcatgttctgtggatataacttttagagggaataataaacgaataaattggt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3474051 |
tatcctcaacattgcaccacaatatagcttgagcaatgagtgagtcatgcatgttctgtggatataacttttagagggaataataaacgaataaattggt |
3474150 |
T |
|
| Q |
253 |
tcacattcc |
261 |
Q |
| |
|
||||||||| |
|
|
| T |
3474151 |
tcacattcc |
3474159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 24 - 120
Target Start/End: Original strand, 3473922 - 3474018
Alignment:
| Q |
24 |
agaggctccatctgaagctcaaatctctattttccacgtacttcagttgccacctaagatctgtccctaataattttaaaataatattcacaattca |
120 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
3473922 |
agaggctccacctgaagctcaaatctctatttttcacgtacttcagttgccacctaagatctgtctctgataattttaaaataatattcgcaattca |
3474018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University