View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7788_low_1 (Length: 311)
Name: NF7788_low_1
Description: NF7788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7788_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 43716570 - 43716376
Alignment:
| Q |
8 |
attattctctagacacaaaattaatcatgttatgatcataggatatacattattaataatttatgcatgatcatgatttggcttttgtgccgccaggact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43716570 |
attattctctagacacaaaattaatcatgttatgatcataggatatacattattaataatttatgcatgatgatgatttggcttttgtgccgccaggact |
43716471 |
T |
 |
| Q |
108 |
attagctatatgtcttgattatgcatgtccagatgcatgtgttgatgtgggttatttgtgacttcgtgtggtcaagtacttgagatgtacatttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43716470 |
attagctatatgtcttgattatgcatgtccagatgcatgtgttgatgtgggttatttgtgacttcgtgtggtcaagtacttgagatgtacatttg |
43716376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 235 - 293
Target Start/End: Complemental strand, 43716343 - 43716285
Alignment:
| Q |
235 |
gaagcaatgtcaccctttaacagaaaatggccgtacggtcccccatttccctcgatcat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43716343 |
gaagcaatgtcaccctttaacagaaaatggccgtacggtcccccatttccctcgatcat |
43716285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University