View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7789_low_9 (Length: 216)
Name: NF7789_low_9
Description: NF7789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7789_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 22 - 122
Target Start/End: Complemental strand, 31338879 - 31338779
Alignment:
| Q |
22 |
ggaccttatatatggattgtcctatgaattgaattaagctcacgagaactaccaaaagagttttataaatagggacggaagtagtgattgtttaaccaca |
121 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31338879 |
ggaccttatataaggattgtcctacgaactgaattaagctcacgagaactaccaaaagagttttataaatagggatcgaagtagtgcttgtttaaccaca |
31338780 |
T |
|
| Q |
122 |
a |
122 |
Q |
| |
|
| |
|
|
| T |
31338779 |
a |
31338779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University