View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7790_low_20 (Length: 293)
Name: NF7790_low_20
Description: NF7790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7790_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 23975613 - 23975891
Alignment:
| Q |
1 |
aaccagggatgacatacttactacgaataatcaatgttgcactcaataatcatcttttcttcaaaatagcaaatcacaatttcacagttgttgcactaga |
100 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
23975613 |
aaccagggatgacatacttgctacggataatcaatgttgcactcaataacaatcttttcttcaaaatagcaaatcacagtttcacagttgttgcactgga |
23975712 |
T |
 |
| Q |
101 |
tgctgactacaccgatccattcaagaccgacgtcatcgttatcgcccctggccaaacggttgatgctttgttcacagcaaaccaacctataggctcatac |
200 |
Q |
| |
|
|||||||||||| |||||||| |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| || ||| |
|
|
| T |
23975713 |
tgctgactacacgaatccattcgagactgacatcatcgttatcgcccctggccaaacagttgatgctttgttcacagcaaatcaacctataggatcttac |
23975812 |
T |
 |
| Q |
201 |
tacatggctgcctctccttacgaagttggtgtccgcgacttcgccaacatcacaactcgtggcattgtcgtttatgatg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23975813 |
tacatggctgcctctccttacgaagttggtgtccgcgactttgccaacatcacaactcgtggcattgtcgtttatgatg |
23975891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 6026096 - 6026172
Alignment:
| Q |
15 |
tacttactacgaataatcaatgttgcactcaataatcatcttttcttcaaaatagcaaatcacaatttcacagttgt |
91 |
Q |
| |
|
||||||||||| || ||||||| |||||||||| | || | ||||||||| |||||||| || | |||||||||||| |
|
|
| T |
6026096 |
tacttactacgcattatcaatgctgcactcaatgaacaacatttcttcaagatagcaaaccatagtttcacagttgt |
6026172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University