View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7790_low_24 (Length: 255)
Name: NF7790_low_24
Description: NF7790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7790_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 19190491 - 19190704
Alignment:
| Q |
19 |
ggagggcgtacgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagtt |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190491 |
ggagggcgttcgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagtt |
19190590 |
T |
|
| Q |
119 |
ttggagggtatggtagggatggtcgtgatagtcgcttcagtggtggatatggctatgttaattaattaggttagaaattatatggttcaagggttttgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
19190591 |
ttggagggtatggtagggatggtcgtgatagtcgcttcagtggtggatatggctatgttaattaattaggttagaaattatatggttcaagggttttggt |
19190690 |
T |
|
| Q |
219 |
gaaactactgattt |
232 |
Q |
| |
|
|| | ||||||||| |
|
|
| T |
19190691 |
gacagtactgattt |
19190704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University