View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7790_low_27 (Length: 229)

Name: NF7790_low_27
Description: NF7790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7790_low_27
NF7790_low_27
[»] chr7 (1 HSPs)
chr7 (27-191)||(45085119-45085283)


Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 27 - 191
Target Start/End: Original strand, 45085119 - 45085283
Alignment:
27 atgacttaattctcaactctcaagtaccgggaaattcgatttattatacacggaattggaccgaaataaacgactccaacaataaaattcaaatatatct 126  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45085119 atgacttaattctcaactctcaagtaccggaaaattcgatttattatacacggaattggaccgaaataaacgactccaacaataaaattcaaatatatct 45085218  T
127 atttcttcccttnnnnnnntgtatctatctcttatccaataagaaaaccaaaaacattttgtacc 191  Q
    ||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||    
45085219 atttcttcccttaaaaaaatgtatctatctcttatccaataagaaaaccaaaaacattttgtacc 45085283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University