View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7790_low_27 (Length: 229)
Name: NF7790_low_27
Description: NF7790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7790_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 27 - 191
Target Start/End: Original strand, 45085119 - 45085283
Alignment:
| Q |
27 |
atgacttaattctcaactctcaagtaccgggaaattcgatttattatacacggaattggaccgaaataaacgactccaacaataaaattcaaatatatct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45085119 |
atgacttaattctcaactctcaagtaccggaaaattcgatttattatacacggaattggaccgaaataaacgactccaacaataaaattcaaatatatct |
45085218 |
T |
 |
| Q |
127 |
atttcttcccttnnnnnnntgtatctatctcttatccaataagaaaaccaaaaacattttgtacc |
191 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45085219 |
atttcttcccttaaaaaaatgtatctatctcttatccaataagaaaaccaaaaacattttgtacc |
45085283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University