View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7791_high_23 (Length: 202)
Name: NF7791_high_23
Description: NF7791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7791_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 122
Target Start/End: Complemental strand, 34836242 - 34836140
Alignment:
| Q |
20 |
tgttatgtgtgtaagattgaaaaatatcaaactaaagggctacgtaatagccgacaatttcacatattcacgctgtcaagacattgttggattgagatct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34836242 |
tgttatgtgtgtaagattgaaaaatatcaaactaaagggctacgtaatagctgacaatttcacatattcatgctgtcaagacattgttggattgagatct |
34836143 |
T |
 |
| Q |
120 |
gaa |
122 |
Q |
| |
|
||| |
|
|
| T |
34836142 |
gaa |
34836140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University