View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7791_low_17 (Length: 281)
Name: NF7791_low_17
Description: NF7791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7791_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 263
Target Start/End: Original strand, 3591472 - 3591716
Alignment:
| Q |
20 |
atactcaacgagtcaatgtaattaaaatcgcaatcttgaaagtgggattgcaccacaatttcacgactcgagaccctcactatgtgaggagcaactgtgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3591472 |
atactcaacgagtcaatgtaattaaaatcgcaatcttgaaagtgggattgccccacaatttcacgactcgagaccctcactatgtgaggagcaactgtgt |
3591571 |
T |
 |
| Q |
120 |
cacacatgggattgccagcaggagggatcgtggtcttttccagcatgatcattggatcgaaggaggaaagccacgaacattgacttgttctgatatccgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
3591572 |
cacacatgggattgccagcaggagggatcgtggtcttttccagcatgatcattggatcgaaggaggaaagcctcgaacattgacttgatctgatatccgg |
3591671 |
T |
 |
| Q |
220 |
gtcagtatttcacaaaaccttcacct-ccccatcctaggtagaat |
263 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3591672 |
gtcagtatttcacaaaaccttcacctcccccatcctaggtagaat |
3591716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University