View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7791_low_22 (Length: 226)
Name: NF7791_low_22
Description: NF7791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7791_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 8750389 - 8750544
Alignment:
| Q |
1 |
ggaacctttaaattatggagttcgatcacattggtgttcagatttgattccttgatgttgatcttcttgtggaatcataaagtgtggtccaaagcacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
8750389 |
ggaacctttaaattatggagttcgatcacattggtgttcagatttggttccttgatgttgatcttctggtggaatcataaagtgtggttcaaagcacttg |
8750488 |
T |
 |
| Q |
101 |
tttttaattaaatcttgcgtttccaatatttagtatcacagttacatctcaattcc |
156 |
Q |
| |
|
|||||| || |||||||| || ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
8750489 |
tttttatttgaatcttgcattgccaattttttgtatcacagttacatctcaattcc |
8750544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 120 - 217
Target Start/End: Original strand, 8750593 - 8750686
Alignment:
| Q |
120 |
tttccaatatttagtatcacagttacatctcaattccttttctttttatacatgcttttacctaccttatggttcaacatttttcattcttctctgct |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8750593 |
tttccaatattttgtatcacagttacatctcaattccttttctttttatacatgcttt----taccttatggttcaacatttttcattcttttctgct |
8750686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University