View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7792_high_26 (Length: 221)
Name: NF7792_high_26
Description: NF7792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7792_high_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 33712861 - 33712674
Alignment:
| Q |
17 |
taattctgttgtacattagtaataaattttggtgcaatgaatcttgaataggtccaacattgagagaaattgattttcaattaattttatatttttctat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33712861 |
taattctgttgtacattagtaataaattttggtgcaatgaatcttgaataggtccaacattgagagaaattgattttcaattaattttatatttttctat |
33712762 |
T |
|
| Q |
117 |
tgttgagtcttttcaaaaatcaatgtattgaataaggagtccctaannnnnnnnngtttcttctttggacagaatcatagacaatatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33712761 |
tgttgagtcttttcaaaaatcaatgtattgaataaggagtccctaatttttttttgtttcttctttggacagaatcatagacaatatg |
33712674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University