View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7792_low_23 (Length: 272)
Name: NF7792_low_23
Description: NF7792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7792_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 32371803 - 32372049
Alignment:
| Q |
18 |
agtttacgagcccagcaacccatacaagttggctcgccaacataatcgttttctggacagatgcgagaaaagctcacgattatggagttcgaannnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32371803 |
agtttacgagcccagcaacccatacaagttggctcacgaacatattcgttttctggacagatgcgagaaaaactcacgattatggagttcgaattttttt |
32371902 |
T |
|
| Q |
118 |
ctaaaaaagcccaaatcgcagtaccgcctcacagtttattgaattctaagagttgtatcctaatatcttctctaatctctagtctttgtgtttctcttaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32371903 |
ctaaaaaagcccaaatcgcagtaccgcctcacagtttattgaattctaagagttgtatcctaatatcttctctaatctctagtctttgtgtttctcttac |
32372002 |
T |
|
| Q |
218 |
atctctgtgtgatactgttgctttgtgtcatctctggctttcatctc |
264 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32372003 |
atctctgtgtgacactgttgctttgtgtcatctctggctttcgtctc |
32372049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 32365038 - 32364989
Alignment:
| Q |
18 |
agtttacgagcccagcaacccatacaagttggctcgccaacataatcgtt |
67 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
32365038 |
agtttacgagtccagctacccatacaagttgactcgcgaacataatcgtt |
32364989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University