View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7793_high_13 (Length: 202)

Name: NF7793_high_13
Description: NF7793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7793_high_13
NF7793_high_13
[»] chr5 (1 HSPs)
chr5 (1-185)||(11025660-11025844)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 11025660 - 11025844
Alignment:
1 tctagatatccttttgttcaatagaattggagactggtaggaaacctcacttgctcaacctaacaagttagctcttttgatatgtaaattgttgaagtac 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025660 tctagatatccttttgttcaatagaatcggagactggtaggaaacctcacttgctcaacctaacaagttagctcttttgatatgtaaattgttgaagtac 11025759  T
101 ataaaagtggtagttggatattcatgggaaatgtaatcataccacatttgctaatattgccatcttgaatatatgctcttcttca 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025760 ataaaagtggtagttggatattcatgggaaatgtaatcataccacatttgctaatattgccatcttgaatatatgctcttcttca 11025844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University