View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7793_low_14 (Length: 290)

Name: NF7793_low_14
Description: NF7793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7793_low_14
NF7793_low_14
[»] chr5 (1 HSPs)
chr5 (1-271)||(5145727-5145997)


Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 5145997 - 5145727
Alignment:
1 aaatcatgttagggtcataatattgtactccttagctatctttttctttcttttaatagcactccctagctatataatggtcccggtgactaatatctaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5145997 aaatcatgttagggtcataatattgtactccttagctatctttttctttcttttaatagcactccctagctatataatggtcccggtgactaatatctaa 5145898  T
101 gtttattgtatgttgtagagggtattggggacacttaaacgaggatttcacatgccataataaccctttctttactacaaaccacgtggcctttcctatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5145897 gtttattgtatgttgtagagggtattggggacacttaaacgaggatttcacatgccataataaccctttctttactacaaaccacgtggcctttcctatc 5145798  T
201 ttttgccccttttttaaatacttcaatatctaaactaactcgagggtaacttcaataacacgtgagagtag 271  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
5145797 ttttgccccttttttaaatacttcaatatttaaactaactcgagggtaacttcaataacacgtgagagtag 5145727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University