View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7794_low_10 (Length: 407)
Name: NF7794_low_10
Description: NF7794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7794_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 18 - 392
Target Start/End: Original strand, 44506828 - 44507201
Alignment:
| Q |
18 |
ttatttatccaatttcttgcaactttctttcataacaattgtcatttctcttacttttaaacacataaactacactgcaaaaccaatcatcaacgcttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44506828 |
ttatttatccaatttcttgcaactttctttcataacaattgtcattgctcttacttttaaacacataaactacactgcaaaaccaatcatcaacgcttgt |
44506927 |
T |
|
| Q |
118 |
ctactaattttttgtccactaattttattgttttggctattacacccttacaaacaaaattaatttgtgcatggaaaaatcctatatggatgtgtcaaac |
217 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44506928 |
ctactaattttt-gtccgctaattttattgttttggctattacacccttacaaacaaaattaatttgtgcatggaaaaatcctgtatggatgtgtcaaac |
44507026 |
T |
|
| Q |
218 |
attaaacatcatgaatttttgaggttgctcatggtacaagtcaacctgattaattcgatgacccaacccgactcaaaatatttggtttaggtttttattt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44507027 |
attaaacatcatgaatttttgaggttgcttatggtacgagtcaacctgattaattcgatgacccaacccgactcaaaatatttggtttaggtttttattt |
44507126 |
T |
|
| Q |
318 |
tagtttggactgaacttgaatcatcctaaaatggtttggttcggttaatattacatgtcaaaccctatgaacgtg |
392 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44507127 |
tagtttggactgaacttgaattatcctaaaatggtttggttcggttaatattacatgtcaaaccctatgaacgtg |
44507201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University