View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7794_low_22 (Length: 264)
Name: NF7794_low_22
Description: NF7794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7794_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 43101916 - 43101682
Alignment:
| Q |
18 |
gttgttaggggaacagctaggccaggtgtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtacttgcgttttggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43101916 |
gttgttaggggaacagctaggccaggtgtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtgcttgcgttttggt |
43101817 |
T |
|
| Q |
118 |
ttgacgttgggtttcgtgggctttggttgggtttgctctcggcccaggtttgttgtgctgggttcatgttgtatgtgattgcgatcactgattgggattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43101816 |
ttgacgttgggtttcgtgggctttggttgggtttgctctcggcccaggtttgttgtgctgggttcatgttgtatgtgattgcgatcactgattgggattt |
43101717 |
T |
|
| Q |
218 |
tgaagctatgcgggcccactttcttactcgtgtgt |
252 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| |
|
|
| T |
43101716 |
tgaagctatgcgggcccacttgcttacttgtgtgt |
43101682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 45 - 175
Target Start/End: Original strand, 33949612 - 33949742
Alignment:
| Q |
45 |
gtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtacttgcgttttggtttgacgttgggtttcgtgggctttggt |
144 |
Q |
| |
|
|||||||| |||||||| | ||||||| ||||||||||| |||||| |||| || | ||||| ||||||||||| |||| ||| | |||||||||| |
|
|
| T |
33949612 |
gtggcggcaaatgtgaatttgagtgctttttatatggtgggaatgccagtggcagttgggcttgctttttggtttgattttggattttgcgggctttggt |
33949711 |
T |
|
| Q |
145 |
tgggtttgctctcggcccaggtttgttgtgc |
175 |
Q |
| |
|
|||| | || || ||||||||||||||||| |
|
|
| T |
33949712 |
tgggccttctatcagcccaggtttgttgtgc |
33949742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University