View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7794_low_26 (Length: 249)
Name: NF7794_low_26
Description: NF7794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7794_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 34828699 - 34828493
Alignment:
| Q |
13 |
aatattgacgagaccaaattactttgtcataacctattgtatgtatgtagtccaagttctagtccagtcagatattatttgacccgttattgaaagatta |
112 |
Q |
| |
|
|||||||| ||||||||| |||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34828699 |
aatattgatgagaccaaa---ctttgtcatagcttattgtatgtatgtagtccaagttctagtgcagtcagatattatttgacccgttattgaaagatta |
34828603 |
T |
|
| Q |
113 |
cttcactgttcgtgtgtgtacta--ggtatatgttgaatgtatcaa----nnnnnnnnggacaaaaaatttactactatgatcaaactttgaattttgta |
206 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34828602 |
cttcactgttcgtatgtgtactaaggttatatgttgaatgtatcaattttttttttttggacaaaaaatttactactatgatcaaactttgaattttgta |
34828503 |
T |
|
| Q |
207 |
ttatttttta |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
34828502 |
ttatttttta |
34828493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University