View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7795_high_7 (Length: 219)
Name: NF7795_high_7
Description: NF7795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7795_high_7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 34880547 - 34880329
Alignment:
| Q |
1 |
tattcttattaattggcatttccctttttgtaataacaaaatattttgacaaagatcagctattatttattaacaaaccaaatagtatgctttaaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880547 |
tattcttattaattggcatttccctttttgtaataacaaaatattttgacaaagatcagctattatttattaacaaaccaaatagtatgctttaaaataa |
34880448 |
T |
|
| Q |
101 |
agcaggacagaaggttaattaattcagctgctttttcccctatataaaacataatttctttcgctaatcatgaaacaaatttgaaagtacaaatttgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880447 |
agcaggacagaaggttaattaattcagctgctttttcccctatataaaacataatttctttcgctaatcatgaaacaaatttgaaagtacaaatttgatt |
34880348 |
T |
|
| Q |
201 |
gtatatgatgtgatcatgt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34880347 |
gtatatgatgtgatcatgt |
34880329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University