View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7795_low_8 (Length: 240)
Name: NF7795_low_8
Description: NF7795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7795_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 40145751 - 40145961
Alignment:
| Q |
18 |
gttcagagcccgtagatagccaagaaaaaattacaaggaaaatggataagtttttccgcgttgttccttccaccccaggtgtaaaggaagtgaaagaatg |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40145751 |
gttcagagccggtagatagccaagaaaaaattacaaggaaaatggataagtttttccgggttgttccttccaccccaggtgtaaaggaagtgaaagaatg |
40145850 |
T |
 |
| Q |
118 |
gttaaaatcgtccacagcaaaggatactggtatcatattataagaacttgaataagcaatcgcggaaaatttgataaaaatcatttagtgaatgatgttt |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
40145851 |
gttaaaaacgtccacagcaaaggatactggtatcgttttataagaacttgtataagcaatcgcggaaaatttgataaaaatcatttattgaatgatgtct |
40145950 |
T |
 |
| Q |
218 |
tctgctttctt |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
40145951 |
tctgctttctt |
40145961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University