View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7796_low_9 (Length: 319)
Name: NF7796_low_9
Description: NF7796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7796_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 220
Target Start/End: Complemental strand, 12185857 - 12185646
Alignment:
| Q |
9 |
gaacatgcagtcattatattgtggaaattgatgcgttgttggaaggtgttgctgcccgccataaagaaatatcaatggcaatcggagccaattgctgctg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12185857 |
gaacatgcagtcattatattgtggaaattgatgcgttgttggaaggtgttgctgcccgccataaagaaatatcaatggcaatcggggccaattgctgctg |
12185758 |
T |
|
| Q |
109 |
ggaccaaatatatagatagggactgcatcaagagccaagaaagaaacacagtattcgactttttgtcatcgacaattacaaagagtgaagtctctaccaa |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12185757 |
ggaccaaatatatggatagggactgcatcaagagccaagaaagaaacacagtattcgactttttgtcatcgacgattacaaagagtgaagtctctaccaa |
12185658 |
T |
|
| Q |
209 |
atctattcaacc |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12185657 |
atctattcaacc |
12185646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 26 - 208
Target Start/End: Complemental strand, 12191378 - 12191204
Alignment:
| Q |
26 |
attgtggaaattgatgcgttgttggaaggtgttgctgcccgccataaagaaatatcaatggcaatcggagccaattgctgctgggaccaaatatatagat |
125 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||||||||||||| ||||||||||| | || | ||| |||| ||||||||| | |
|
|
| T |
12191378 |
attgtggaaattgatgcattgttggaaggcgtctctgcccgccataaagaaagatcaatggcaaaccaagtcgatttctgccgggaccaaaga------- |
12191286 |
T |
|
| Q |
126 |
agggactgcatcaagagccaagaaagaaacacag--tattcgactttttgtcatcgacaattacaaagagtgaagtctctaccaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
12191285 |
---gactgcatcaagagccaagaaagaaacgcataatattcgactttctgccatcgacgattacaaagagtgaagtctctaccaa |
12191204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University